90
|
TransGen biotech co
pgem-t easy vector Pgem T Easy Vector, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/10__7589_slash_jwd___d___21___00137-39-7-10?v=TransGen+biotech+co Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy vector Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc06063811-162-5-8?v=Promega Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
atipk1 cdna vector pgem-t easy Atipk1 Cdna Vector Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc01386007-126-13-20?v=Promega Average 90 stars, based on 1 article reviews
atipk1 cdna vector pgem-t easy - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Laragen Inc
pgem t easy vector Pgem T Easy Vector, supplied by Laragen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc03625875-127-6-12?v=Laragen+Inc Average 90 stars, based on 1 article reviews
pgem t easy vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy shuttle vector Pgem T Easy Shuttle Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc03103646-211-13-17?v=Promega Average 90 stars, based on 1 article reviews
pgem-t easy shuttle vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy ta cloning vector; ampr Pgem T Easy Ta Cloning Vector; Ampr, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/10__1128_slash_aem__00642___07-98-57-58?v=Promega Average 90 stars, based on 1 article reviews
pgem-t easy ta cloning vector; ampr - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t vector manual  Pgem T Vector Manual, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc05023260-20-10-9?v=Promega Average 90 stars, based on 1 article reviews
pgem-t vector manual - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
pgem-t easy vector Pgem T Easy Vector, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc04852462-48-7-13?v=GATC+Biotech Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy vector system ι Pgem T Easy Vector System ι, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc04185888-236-7-12?v=Promega Average 90 stars, based on 1 article reviews
pgem-t easy vector system ι - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy transcription vector constructs Pgem T Easy Transcription Vector Constructs, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pm17823257-36-1-6?v=Promega Average 90 stars, based on 1 article reviews
pgem-t easy transcription vector constructs - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
commercial cloning kit pgem Commercial Cloning Kit Pgem, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/pmc01855587-181-7-10?v=Promega Average 90 stars, based on 1 article reviews
commercial cloning kit pgem - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
128 pgem-t easy vector 128 Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem+%C2%AE+-t+easy+vector+system+technical+manual/10__1530_slash_rep___17___0477-33-7-11?v=Promega Average 90 stars, based on 1 article reviews
128 pgem-t easy vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Microorganisms
Article Title: Sulfur Oxygenase Reductase (Sor) in the Moderately Thermoacidophilic Leaching Bacteria: Studies in Sulfobacillus thermosulfidooxidans and Acidithiobacillus caldus
doi: 10.3390/microorganisms3040707
Figure Lengend Snippet: Polymerase chain reaction (PCR) primers used in this study.
Article Snippet: T7 , taatacgactcactataggg , Promoterregions , 158 bp ,
Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation